Please use this identifier to cite or link to this item:
Title: Palindromes in SARS and other coronaviruses
Authors: Chew, D.S.H. 
Choi, K.P. 
Heidner, H.
Leung, M.-Y.
Keywords: Markov chain
Palindrome counts
RNA viral genome
Severe acute respiratory syndrome
Issue Date: Sep-2004
Citation: Chew, D.S.H., Choi, K.P., Heidner, H., Leung, M.-Y. (2004-09). Palindromes in SARS and other coronaviruses. INFORMS Journal on Computing 16 (4) : 331-340. ScholarBank@NUS Repository.
Abstract: With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.
Source Title: INFORMS Journal on Computing
ISSN: 08991499
DOI: 10.1287/ijoc.1040.0087
Appears in Collections:Staff Publications

Show full item record
Files in This Item:
There are no files associated with this item.


checked on Jan 17, 2019


checked on Jan 9, 2019

Page view(s)

checked on Jan 18, 2019

Google ScholarTM



Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.